Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922D6
Clone ID IST10922D6
Vector VICTR76
Project tigm

Sequence tag IST10922D6HMF1
Sequence
TGTGTAACCTTGGCTGTCCTGGAACTCACTGTGTANACCAGGCTGGCCTTGAACA
Sequence Type genomic DNA
Unitrap ID UNI31645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570967..40571020 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34912247..34912300 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10117505..10117558 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667049..152667102 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066842 (Hmcn1) NP_001019891 hemicentin 1 Gene [Source:MGI (curated);Acc:Hmcn1-001]


Sequence tag IST10922D6HMR1
Sequence
CACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGC
Sequence Type genomic DNA
Unitrap ID UNI32257 UNI32417 UNI32506 UNI32955 UNI34447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4689358..4689396 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3228853..3228891 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3081042..3081080 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3380486..3380524 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3605586..3605624 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8939179..8939217 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3011965..3012003 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3269542..3269580 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3415999..3416037 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023800 (Tiam2) NM_011878 T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3758949..3758987 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3109341..3109379 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3530267..3530305 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6689844..6689882 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3964891..3964929 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4551929..4551967 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3889047..3889085 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3133972..3134010 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4755002..4755040 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022322 (Shcbp1) NM_011369 Shc SH2-domain binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1338802]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4662363..4662401 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025892 (Gria4) NM_019691 glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 294872..294910 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042901 (2610208M17Rik) NP_859421 axin interactor, dorsalization associated Gene [Source:MGI Symbol;Acc:MGI:1919737]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 19270..19308 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3158515..3158553 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 475607..475645 39
NO GENE  


Sequence tag IST10922D6BBF1
Sequence
TGTGTAACCTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTT

Sequence Type genomic DNA
Unitrap ID UNI31645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667053..152667102 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066842 (Hmcn1) NP_001019891 hemicentin 1 Gene [Source:MGI (curated);Acc:Hmcn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86630706..86630755 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10117509..10117558 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34912247..34912296 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570971..40571020 48
NO GENE  

 
Come back to gene ENSMUSG00000066842


For any suggestions or comments, please send an email to unitrap@crg.es