Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990A1
Clone ID IST14990A1
Vector VICTR78
Project tigm

Sequence tag IST14990A1HMF2
Sequence
AGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCC
GTAACGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTT
AAAAAAAAAAAAAAAAANCNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 300490..363732 165
NO GENE  


Sequence tag IST14990A1BBF1
Sequence
NNGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATC
CGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32919 UNI32920 UNI34318 UNI34449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88435786..88435877 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75521877..75521968 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020226 (Slc5a4b) NP_075708 solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI (curated);Acc:Slc5a4b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103382417..103382508 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84988204..84988295 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 50544241..50544332 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21245971..21246062 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039543 (Ttc18) tetratricopeptide repeat domain 18 Gene [Source:MGI Symbol;Acc:MGI:1923920]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 31444953..31445044 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16545006..16545097 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33175192..33175283 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36755536..36755627 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 53838248..53838339 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65237239..65237330 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66872804..66872895 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108406153..108406244 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034557 (Zfyve9) NM_183300 zinc finger, FYVE domain containing 9 Gene [Source:MGI (curated);Acc:Zfyve9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67846336..67846427 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72481417..72481508 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52139275..52139366 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002968 (Med25) NM_029365 mediator of RNA polymerase II transcription, subunit 25 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922863]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11493476..11493567 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3310632..3310723 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20413463..20413554 92
NO GENE  

 
Come back to gene ENSMUSG00000002968


For any suggestions or comments, please send an email to unitrap@crg.es