Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-9F1
Clone ID FHCRC-GT-S10-9F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-9F1
Sequence
GCAGTGATGGCTTCCAAGCGCATCACCCAGGAAACCTTTGATGCTGCAGTGCGGGAGAACATTGAGGAGTTTGAGATGGG
CACTGAGGAGGCCATTCGAGAGGCTGTGGAGCAGTTTGAATCACAAGGGGTTGATCTGAGCAACATTGTGAAGACAATAC
CGAAAGTATCACTGGATGGCCTTCAGGAGCCCACACATAGTGTCCTTCAGG
Sequence Type genomic DNA
Unitrap ID UNI14484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72753426..72755305 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002343 (Armc6) NM_133972 armadillo repeat containing 6 Gene [Source:MGI (curated);Acc:Armc6-001]

 
Come back to gene ENSMUSG00000002343


For any suggestions or comments, please send an email to unitrap@crg.es