Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-8B1
Clone ID FHCRC-GT-S10-8B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-8B1
Sequence
ACCTTCAACCATTGGTTGAAAGTAGTATACCTAGTTCTATCACTGCAGTAGAATTCCTTATAGATAAGCAACTGGATTTT
TTAACAGAAGATAGTGCCTTTCAGCCTGATCTACAGAGTGAGTTCTAGGACAGCCAGAGCTACACAGAGAAACCCTGTCT
CGAAAAATCAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66652484..66662410 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es