Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-7E1
Clone ID FHCRC-GT-S10-7E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-7E1
Sequence
GCATGTCATGTTACCCAGAGAACTCTCTAAACAAGTACCCAAAACTCATCTGATGTCCGAAGAGGAGTGGAGGAGACTTG
GTGTCCAACAGAGTCTAGGATGGGTTCATTACATGATTCATGAGCCAGAACCGCATATTCTTCTCTTTAGACGACCTCTT
CCAAAAGAACAACAAAAATGAAGTGCAGCTGGGATCATCTAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAG
TATTCAGTGAATACTTGAAAAGTGTACAAACCTTTCATCCATACCTGTGCATGCGCTGTATTCTTCACAGCAACAGAGCT
CAGTCAAATGCAACTGCAAGTAGGGTTGTTTTAAGTTGTTCAAGATAGTTTCTTGTAGTTTTTTCTTAATATAAATGCCT
GTTTTATTTTACCTGTTTTGTTAAATAAAGTTTGTATATTGCATTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI12063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51744954..51746024 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062248 (Cks2) NM_025415 CDC28 protein kinase regulatory subunit 2 Gene [Source:MGI (curated);Acc:Cks2-001]

 
Come back to gene ENSMUSG00000062248


For any suggestions or comments, please send an email to unitrap@crg.es