Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-7C1
Clone ID FHCRC-GT-S10-7C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-7C1
Sequence
CGGGAGCCCAGCATTGACCTGCTGCAGGCCTTCGTGGAACATTGGAAAGGCATCACACACTACTATATCGAGAGCACAGA
TGAAAACACCCCAGCCAAGAAAACAGATATCCCCTGGCGACTGAAGCAGATGTTGGACATCCTGGTGTATGAGGAGAAGC
AGCAGGCATCCTCTGGTGAGGCTGGACCCTGTCTGGAATACTTGCTACAACACAAGATCCTGGAGACCCTGTGCACTCTG
GGCAAAGCGGAGTATCCCCCAGGCATGCGACAACAGGTGTTCCAGTTCTTCAGCAAGGTCCTGAGCCAGGTGCAGCACCC
ACTGCTGCACTACCTGAGTGTGCACAGGCCTGTGCAGAAACTTCTCCGACTTGGAGGGACAGTCCCTGGATCCCTCACAG
AAAAGGAAGAAGTTCAGTTCACCAGTGTCCTCTGCTCTAAGATACAGCAGGATCCAGAGCTGCTGGCCTATATTCTAAAG
ANAACTCAAAGCGAGGCAACACTAGAGATAGAAACCCTAGGAAAGAAATCTGGAACCATAGATTTGAGCATCAGCAACAG
AATACAAGAGATGGAAGAGAGAATCTCAGGTGCAGAAGATTCCATAGAGAACATCGGCACAACAATCAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70989936..70993854 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022095 (Rai16) family with sequence similarity 160, member B2 Gene [Source:MGI Symbol;Acc:MGI:3036290]

 
Come back to gene ENSMUSG00000022095


For any suggestions or comments, please send an email to unitrap@crg.es