Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-5B1
Clone ID FHCRC-GT-S10-5B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-5B1
Sequence
CACATACAGAAATCCAGAACTTGATCGAATAGCATCCGAGGATGATCTGGTGGAAATACAGGGCTACAGAAACAAGCTTG
CTGTCATTGGGGAGGTGCTGTCTCGGAGACATATGAAGGTGGCATTTTTTGGCAGGACAAGTAGTGGCAAGAGCTCTGTC
ATCAATGCAATGCTGTGGGATAAAGTCCTCCCCAGCGGGATTGGTCACACAACCAACTGCTTCCTGAGTGTCGAGGGGAC
CGATGGAGATAAAGCCTACCTTATGACCGAAGGGTCAGATGAAAAGAAAAGTGTGAAGACTGTTAATCAGCTGGCCCATG
CCCTCCATATGGATAAAGACTTGAAAGCTGGCTGTCTTGTGCATGTATTTTGGCCCAAAGCAAAATGTGCCCTCTTGAGA
GATGACCTGGTTTTAGTAGACAGCCCAGGTACAGATGTCACCACAGAGCTGGATATCTGGATTGATAAGTTTTGCCTTGA
TGCTGATGTCTTTGTTTTGGTTGCAAACTCGGAATCAACACTGATGAACACGGAGAAACATTTTTTCCATAAGGTGAATG
AGCGGCTCTCCAAGCCCAACATCTTCATTCTGAATAACCGTTGGGATGCTTCTGCTTCGGAGCCGGAGTACATGGAGGAT
GTGAGTTTGTCCCCTTTGTTTGAACTGCACTCATGTACAGTGTTGTCTGCGAAAACAGTAGACCTCAGAGAGTGTCTTGA
Sequence Type genomic DNA
Unitrap ID UNI14491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32433162..32445697 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027668 (Mfn1) NM_024200 mitofusin 1 Gene [Source:MGI (curated);Acc:Mfn1-001]

 
Come back to gene ENSMUSG00000027668


For any suggestions or comments, please send an email to unitrap@crg.es