Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10226B5
Clone ID IST10226B5
Vector VICTR76
Project tigm

Sequence tag IST10226B5BBF1
Sequence
GTCACAAGGAAGACCTTACTCAAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10226B5HMF1
Sequence
NTCACAANNNNNNCTTACTCAAAGATCTGCCCTCTGACCAGTTCTGTNATGGA
Sequence Type genomic DNA
Unitrap ID UNI24858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57653743..57653781 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es