Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-11H1
Clone ID FHCRC-GT-S10-11H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-11H1
Sequence
TGTTGGACGTTCCTGGGCTGGAAGTCACAGTGGTAACAACAGAGAGAGCCAAACATTTCTACAGCCCTCAGGATGTCCCA
GTCACCCTCTACAGTGACGCTGATGAATGGGAGATGTGGAAGCGCCGTTCTGACCCGGTTCTCCACATTGACCTGCGGAG
GTGGGCTGACCTCATGCTAGTGGCTCCCCTCGATGCCAACACTCTGGGGAAGGTGGCCAGTGGCATCTGTGACAATTTGC
TTGACCAAGCCAGAGCCTGAGTGGAAATGATGAGGGATGAAGAGACAGCCCTCCCTCCCAAGGATGCAAGAACAGATCTC
TGTAGATGGGTGATACCCCGTCATCCTTAGGCAACAGCTGCTCTGCTGACCATGGCAAGGACAGTAGGGAGGATTTGGGG
GGACCGAGAAGGGTTAGTAGGCAGAGCATCAGCATCTCCCCCCACTCCCCTTCTTTATAGACCTGTG
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57263055..57282726 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es