Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12989B6
Clone ID IST12989B6
Vector VICTR76
Project tigm

Sequence tag IST12989B6BBF1
Sequence
GTATTCCTGGCTGGCCTAGAGCTTACTATGTANACCAAGCTGGCCTTGAACTAANAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86469602..86469663 58
NO GENE  


Sequence tag IST12989B6HMF2
Sequence
CCTAGGCTCAAGATATAGGAACCAAAGACTGAAGCCTGCCTCTTTCAGGCCTCTTGTCCCAGGTTTGGGTTCCCCAGCCC
TCCCAGGGCCAAGCACCATGTCCATCCTAGGTCANAAGTTGAGCTGCCACCGGGGGTGCTGCANAAAAAGGAGGAGCCAG
AAGGCAGCCACAGTGAATCCTCACTGTCCTCGAAACANCACAAAAAAGCCAAGAAACGCAAGAGTGGCGGGGCTCCTGTG
CCGCCCGCTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI34454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108233190..108233442 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013158 (4933405L10Rik) NP_081931 RIKEN cDNA 4933405L10 gene Gene [Source:MGI Symbol;Acc:MGI:1918296]

 
Come back to gene ENSMUSG00000013158


For any suggestions or comments, please send an email to unitrap@crg.es