Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14161G3
Clone ID IST14161G3
Vector VICTR74
Project tigm

Sequence tag IST14161G3HMR1
Sequence
CATCACAGACAGGGAAGCTCAGTAGCCGAAGACACCGAATTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32262697..32262742 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]

 
Come back to gene ENSMUSG00000027663


For any suggestions or comments, please send an email to unitrap@crg.es