Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S10-10F1
Clone ID FHCRC-GT-S10-10F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S10-10F1
Sequence
GCAGACTGAGCTCTTACTTCTGGGGACGAAGGAAAATCCAGGATTAAAGACAATCCAGGCCACCCTGTCTAGGCAAGGGA
TCGACCATGAGTATCTTTCGTCAGTGGATTTAAAGCAACGCTTTCCAAACATTCGGTTCACCAGGGGAGAAGTGGGGCTC
TTGGACAAGACTGGAGGTGTCCTCTATGCAGACAAGGCCCTCAGAGCCCTCCAGCATATAATTTGTCAGCTAGGAGGCAC
TGTGTGTGATGGAGAGAAGGTAGTGGAGATAAGACCTGGTCTACCCGTCACAGTGAAAACCACCTTGAAGAGCTACCAAG
CCAACAGCTTGGTCATCACTGCTGGTCCCTGGACCAACCGGCTTCTGCATCCTCTGGGGATTGAGTTGCCTCTCCAGACC
CTTAGGATCAATGTGTGTTACTGGCGAGAGAAGGTCCCTGGGAGCTATGGTGTATCACAAGCTTTTCCATGCATCCTGGG
TCTGGATCTGGCCCCCCACCACATCTATGGACTGCCAGCATCCGAGTACCCGGGGCTGATGAAGGTAAGGAGAAAAGTGG
TGAAGGTAAGGAGAAAAGACTAAGAAAGCTACTGAACTACTAAGTGCCCATGGAGGTCTTGGTATCCATGCTAACATCCC
TCTCTAGGACCCTCCTGGAGTCTGTTTCACTATTGGCCACCTGCAGCACAAGCTCTTAAACACAGGGCAGGGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77695946..77697494 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es