Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14570C2
Clone ID IST14570C2
Vector VICTR74
Project tigm

Sequence tag IST14570C2BBF1
Sequence
ATATGTATGCAGATATGCAGATAAGGTGGCGTAAAAGCCATGCTTGGACTCTCTACTTGGACAGTTTGACAAGGACAGGG
ATGGACGGATCACGGTGGCGGAGCTGCGGCAGGCAGCACCAGCTCTGCTGGGGGAACCACTAGAGGGCACTGAACTGGAT
GAGATGTTGCGAGAAATGGACCTCAATGGGGATGGCACCATAGACTTTGACGGTGAGTCACCCTACAGACACCTCTCCCA
TGCCTCTAGCACCGTGAACCTCCTTCAATCCCTGACCTGGATTGGCCTTTCCCTTCCCTCTCTCCTGCAGAGTTTGTAAT
GATGCTATCTACAGGCTGAGGCACCTTCAGGGACAACCTACTGGCCCTGGAGGCCAAGACACCAGCAGANACCAGACTAC
CACACCCTTCCCCAGCATGGAGAAATCCCCCTTCCCCCANGCTGGTTCACCCCCTCACCACACCCAACTCCANANTCTGC
CTGTGCTGTCTTCTCCCATCCCCAAGCTGTGGANANAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI26057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4135800..4136325 514
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024842 (Cabp4) NM_144532 calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]


Sequence tag IST14570C2HMF1
Sequence
ATATGTATGCAGATATGCAGATAAGGTGGCGTAAAAGCCATGCTTGGACTCTCTACTTGGACAGTTTGACAAGGACAGGG
ATGGACGGATCACGGTGGCGGAGCTGCGGCAGGCAGCACCAGCTCTGCTGGGGGAACCACTAGAGGGCACTGAACTGGAT
GAGATGTTGCGAGAAATGGACCTCAATGGGGATGGCACCATAGACTTTGACGGTGAGTCACCCTACAGACACCTCTCCCA
TGCCTCTAGCACCGTGAACCTCCTTCAATCCCTGACCTGGATTGGCCTTTCCCTTCCCTCTCTCCTGCAGAGTTTGTAAT
GATGCTATCTACAGGCTGAGC
Sequence Type genomic DNA
Unitrap ID UNI26057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4135986..4136325 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024842 (Cabp4) NM_144532 calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]

 
Come back to gene ENSMUSG00000024842


For any suggestions or comments, please send an email to unitrap@crg.es