Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14291E2
Clone ID IST14291E2
Vector VICTR74
Project tigm

Sequence tag IST14291E2HMF1
Sequence
AGCCACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCA
CCAGCCCTTATTATG
Sequence Type genomic DNA
Unitrap ID UNI5651 UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70674909..70675000 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020817 (Rabep1) NM_019400 rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI (curated);Acc:Rabep1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165697942..165698033 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14291E2HMR1
Sequence
GGCTNACAACCNTCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATA
ATAAATAAATCTTAAAAAAATGCATAATAAATGAAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es