Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S9-4D1
Clone ID FHCRC-GT-S9-4D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S9-4D1
Sequence
CATGTCTTCAGAGTCCCTCATCAGGAAGAGAATGGCTGTGCGGACTTTTTTATCCGTGGAGAGAGACTCAGAGACAAAAT
GGTGGTTTTGGAATGTATGCTTAAGAAAGACCTCATCTATAATAAGGTCACTCCCACATTTCACCACTGGAAGATCGATG
ACAAGAAGTTTGGCCTTACCTTTCAGAGTCCTGCTGATGCCAGGGCTTTTGATCGAGGCATTCGAAGAGCTATAGAGGAT
ATATCTCTAGGGTGCCCAGCGTCAAAAACTGAGGCTGAAGGAGGAGATGATGATTTACAAACGACTGAAGAAGACACTTC
CCGTTCCCTAGTGAAAGATCACTTTTTCCAGCAAGAGACAGTTGTTACCAGTGAACCTTACAGAAGCTCAGACATAAGAC
CGTTACCCTTTGAAGATCTGAATGCCAGAAGAGTCTACTTGCAAAGCCAAGTCAGCCAGATACCATTCAGTCAGCAAGGC
CTANACATTCAGAGCCGAAGTATGGAATATGTACAGCGGCAAATATCTAAGGAATGTGGGAGCCTAAAGTCCCAAACTAG
GGTCCCTTTGAAGTCAATCAGACATGTCAGCTTTCAAGATGAGGATGAGAT
Sequence Type genomic DNA
Unitrap ID UNI14509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 116978824..117003087 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027351 (Spred1) NM_033524 sprouty protein with EVH-1 domain 1, related sequence Gene [Source:MGI (curated);Acc:Spred1-001]

 
Come back to gene ENSMUSG00000027351


For any suggestions or comments, please send an email to unitrap@crg.es