Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S9-3C1
Clone ID FHCRC-GT-S9-3C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S9-3C1
Sequence
ATACTATTCGTTACTTGTCCTTGCATGACAATAAATACATCAGATACTTTCCTGAGGCCACAGACCTGAGTTATGTTCCG
AATTGGTAGGAAAAGGTGCAACTGGAGAGTATATGGTCACAGGGTAATAAGAAAGAGGGAGAAAGCAGAGATGGCAGTTT
GGGGATGTGTCCCTGGGATGTATTCACTGCCCTCTGATATGACAGCTGACACTGCACTGTTCAACCACCAGCCACTGGGG
TATTTTTTAATAAATTATTCCCTGTTGTAACTGACAATTAGTGCTTATGAAGGAAAATTGGAAGATCTTTAAGAACCAGT
TTGCCACCCAAGTGGTACCACTGTTTAAATCTTGATGTTAAATGTTCCTTTAGATATCTCTGTGCATAAACTTTGGTGTT
TACATAGTTGTTATTCTACTGTACATACAATTTTGTCCTTTTTGTACTTAACATATAAACTTTTTTTGCCATGTTAAAAA
AAAAA
Sequence Type genomic DNA
Unitrap ID UNI13270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106082897..106093437 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020257 (Wdr82) NM_029896 WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]

 
Come back to gene ENSMUSG00000020257


For any suggestions or comments, please send an email to unitrap@crg.es