Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241D1
Clone ID IST14241D1
Vector VICTR74
Project tigm

Sequence tag IST14241D1HMR1
Sequence
GAGATGGTGGGTCNCCATCACACCTGCATCTTTGGCTGAAGAGAGAGAAGAGTGAGGTCCCCGGGCTCAGACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI17447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148187685..148187760 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14241D1HMF1
Sequence
TCCCCAAGAATCGGATTTTTCTGAAATTCCCAAAGAACCCCAGGACTAGTGGGCCCGGAAATGGCCCTCACATAGCAAAC
TGCACAGCTGAGCTCCCTGGGGCGAGGGGGGCGGCTGAGAAGCTGGCACAGCCCCTGTGGGTATCCTGCCAGCAATTANT
GCTGGGGAAGGGTGCCNGGCCNGNCNNANCGCATTCCCNACCCCTTCTTCNCNTTTATACNCNCNCNCNNNANACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14241D1BBF1
Sequence
TCCCCAAGAATCGGATTTTTCTGAAATTCCCAAAGAACCCCAGGACTAGTGGGCCCGGAAATGGCCCTCACATANCAAAC
TGCACAGCTGAGCTCCCTGGGGCGAGGGGGGCGGCTGANAAGCTGGCACANCCCCTGTGGGTATCCTGCCANCNNNTNNN
GCTGNGNANNGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148187536..148187686 145
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es