Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243B6
Clone ID IST12243B6
Vector VICTR76
Project tigm

Sequence tag IST12243B6BBF1
Sequence
GGGCCCACTAATTCACACTCCGGTGAAGGGGCACGAAGCACAGACTTGGACATTATCGCCCCAGTTTCCCAACTTAATAG
AACTAGACTCGCCCCTTCCTTGCTTCCCAAGCTGCATCTGGCCTTCGTGTCTCACTTCCGGCCTGTGGCTCTCTTCTTCC
GCTTCTCTATGGTCGCGAGCCGGAAGTGGCTACCCGGCTGGAAGGCGTGAGGAGCATTCTGGTGAGCGAGGGTAGAGGGC
TGCTGGCTGGGGCTGCAGGTCCTCGCTGGGCGATCCGGGCTTGATGTGCAGACGGCACGGAGCGTGTCCGCGGGCTGGGG
TCCTCACCTGTCGGGGTCCCCCAGGCTCGTGGCGGTTTTCTAGGAACTAACCGGAGCAGCATCCTCTGTCCCCATTGTAG
TCTCCCGAGAGTGCTGCTGCTGGTGGTGACCCTCGTCGATGGTCCTCTTGGGCGTGTGGCAAACGCTCCTGGGTGGCGGT
TGGCTTTCCCGGGTTTTCCGTGCCACCCTTGTGGGTTTTGTCNNATGANTCCNCCNCN
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4795161..4795695 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]


Sequence tag IST12243B6HMF1
Sequence
GGGCCCACTAATTCACACTCCGGTGAAGGGGCACGAAGCACAGACTTGGACATTATCGCCCCAGTTTCCCAACTTAATAG
AACTAGACTCGCCCCTTCCTTGCTTCCCAAGCTGCATCTGGCCTTCGTGTCTCACTTCCGGCCTGTGGCTCTCTTCTTCC
GCTTCTCTATGGTCGCGAGCCGGAAGTGGCTACCCGGCTGGAAGGCGTGAGGAGCATTCTGGTGAGCGAGGGTAGAGGGC
TGCTGGCTGGGGCTGCAGGTCCTCGCTGGGCGATCCGGGCTTGATGTGCAGACGGCACGGAGCGTGTCCGCGGGCTGGGG
TCCTCACCTGTCGGGGTCCCCCAGGCTCGTGGCGGTTTTCTAGGAACTAACCGGAGCAGCATCCTCTGTCCCCATTGTAG
TCTCCCGAGAGTGCTGCTGCTGGTGGTGACCCTCGTCGATGGTCCTCTTGGGCGTGTGGCANACGCTCCTGGGTGGCGGT
TGGCTTTCCCGGGTTTTCCGTGCCNCNNTTGNGGGTTTTGN
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4795161..4795680 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es