Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S9-11E1
Clone ID FHCRC-GT-S9-11E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S9-11E1
Sequence
AAACAGAGGAAAGAGGAGACTGGAAACCAGGTGGTCAACTGCTCTTTCAGCCAAGTTTCAGAACACGAGTGTATGTGGTG
AGTGACTTCCTTCGGTTGTATGGTGAGAAGGAAGAATATTCCAGGCCTAGTGTGACCTGATACCTACGGTATGTGAACCC
TTAATTCCAGCACTCAGGAGGAAGAAGCAAGTAGATTCTGAATCTGAGGCCAGGGCTACACAGAGACTCTTGTCTAAAAA
AAAAA
Sequence Type genomic DNA
Unitrap ID UNI14517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153484399..153484643 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]

 
Come back to gene ENSMUSG00000027478


For any suggestions or comments, please send an email to unitrap@crg.es