Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0295
Clone ID AC0295
Vector pGT0lxr
Project sanger

Sequence tag AC0295
Sequence
AGGAGGCTTCTCAGACAGTCGGCTCCATGAAGAGGAAGTGCTCCCACGAGGATTGCTCCAGGAAGATCATCAAGATGGAG
TCCACAGAGGAGAACGAGGACAGGTTGGCCACAAGCTCCCCCGAGCAGTCCTGGCCCAGCACTTTCAAGGCCACCTCCCC
TCCCCATCTGGAGGGGACTTCCAACCCTGAGAGCACCGTCCCTGAAAAAAAGATCCTCCTGCCCAACAACAATCATGTTA
CCAGTGACACAGGGGAAACAGAGGAGCGAGTTGTGGTGATCAGCAGCTCAGAGGATTCGGACACCGAGAATCTG
Sequence Type mRNA
Unitrap ID UNI2427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58077162..58077895 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es