Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14231B6
Clone ID IST14231B6
Vector VICTR74
Project tigm

Sequence tag IST14231B6HMR1
Sequence
TCCTAACCCGATCACCCACTGAGTACAAGCGGCAAGTTACCAACTTTTCAAAGTCTATTGTGTGCCCTTTAAATACCTAG
CTGGCTTGGCAGAAATGAAGTAAATGGATTTCTTTTAAGGAGTGGAGACAGCATCCCTGCTGTAAAAGGGCANATAGGA
Sequence Type genomic DNA
Unitrap ID UNI16842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72656625..72656783 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]


Sequence tag IST14231B6BBF1
Sequence
GGAAACCTTTATTTNACTTTTTTAGTGCTACCAACTGTTGGAAAAAAAATGCGTGACTAATTGGTCCTTACTGTCTAAAA
AGGATAGGAGATTGCTTAATCNACCAATACACATTTTTATCANAGCANAGGAAATGCTTTATCCAAGCATACACAAGCCC
CAGGTCCCCCAAAATAAAGCACTCCTGCCATCANAGCAAAAGCTTGTTGATTTGAGCCAACAAAANAAGTGGGGGTCTTG
GTGGGAGTTGTTTTTTTTNTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72656366..72656627 244
NO GENE  

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es