Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S7-6E1
Clone ID FHCRC-GT-S7-6E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S7-6E1
Sequence
CATCTCTGGGAAGAACCCCACTGATACCTACCTGGACGCCATGATAAACGAGGCCCTGAGCCCCATCAATTTCACCATGT
TCCTCACAATGTTTGGAGAGAAACTGAATGGAACTGACCCCAAGGACGTCATCAGAAATGCCTTTTCTTGCTTCGATGAG
GAAGCCACAGGCACCATCCAGGAGGATTACCTGAGGGAGCTGCTGACCACCATGGGCGACCGCTTCACAGACGAGGAGGT
GGATGAGCTGTACAGAGAGGCCCCCATTGACAAAAAGGGGAACTTCAACTACATTGAGTTCACACGTATCCTGAAGCACG
GAGCAAAAGACAAAGATGACTGAAGAGCTGCGGCTGCTGACACGCCTCTTGTGTTTGCTTGCTCACTTCCTGTCTCAGAC
ACACACACCCAATAGGACCTACTGCGTGCCACTTAGTTTCTCAGTCACTTCCCCTCCCCCATAGGACCTACTGCGTGCCA
CTTAGTTCAGAGCTTTTCCTCTTTTTTTAAATGTATTTATTCCAGACCCTTTCTGTCACTTAGCATGTGTATAATCAGAC
TGGAACGGAGGGCAATGTTGTAAATTGTACTGAAAACGAGATGCAAATAAAAAATGAACCACTCTGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156026..3156654 619
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es