Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14157F12
Clone ID IST14157F12
Vector VICTR74
Project tigm

Sequence tag IST14157F12HMR1
Sequence
NNNNNACNNNNCCNACNTACCNNNNNNNNNNGGGTNNNTGNNANNNTGNGGGGTTGGGGAGTCAGCAGTGAGCCAGCAGA
GCTCTATCCTTGCCTGCCCTCGCTACCGTCTATACCACCTGCCCTGTGCTCAGGCCTTACCCCGTTGCTATCGATGCAGG
TGGCATTGCTGAGGGGACAGTCACAGCTGCGGCCTGTCCAACCAGGCTCACACACACACTCTCCCATANAACAGCGACCC
CGGTCTGTAAAGAGAGGAAGGGACAGAANAGTANAACCACATTCCTATATGCCATTCAAGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115849716..115849968 247
NO GENE  


Sequence tag IST14157F12BBF1
Sequence
CTGCAACCAGCAGTCGCTCTACACGGACACCACCTGTGANATCAACTACTCTGCGGTGAGGCAAGGGCTCCTGGGGTGTG
GGCATGGGAACCCCAGGAACTGCGGTGGCTGGGAAGGANACGCTGGCTGANCGCACTAGGGAAAGGGAGTTGGGTCCACC
CAGCATAGTGTCTGTTCTCCTCTCCCCANATACNCCTGGGTCTCTGTGAGGATCTCCGCTCCTGCGTACAGTGCCAGGCC
TGGGGCACCGGGGANAANAAAGGGCGCGCGTGTGACGATTGCCCCTTTAAAGTCNAGATGGTANACGAGCTTAANAAAGG
TANGGGCGGCAGCGTGATACCCTACAGCCTTAATACCAGCACTTGGGANACAGCANCAGGTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI34465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115850015..115850401 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020758 (Itgb4) NM_001005608 integrin beta 4 Gene [Source:MGI (curated);Acc:Itgb4-001]

 
Come back to gene ENSMUSG00000020758


For any suggestions or comments, please send an email to unitrap@crg.es