Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S7-2D1
Clone ID FHCRC-GT-S7-2D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S7-2D1
Sequence
GCACGAGATGTGCGTACTAATGAAGTGGTGGCCATCAAGAAAATGTCTTATAGTGGAAAGCAGTCTACTGAGAAATGGCA
GGATATTATTAAGGAAGTCAAGTTTCTACAAAGAATAAAACATCCCAACAGTATAGAATACAAAGGCTGCTATTTACGTG
AACACACAGCATGGCTTGTAATGGAATATTGTTTAGGATCTGCTTCAGATTTATTAGAAGTTCATAAAAAGCCATTACAA
GAAGTGGAAATAGCAGCAATTACACATGGTGCTCTCCAGGGACTAGCTTATTTACATTCTCATACCATGATCCATAGAGA
TATCAAAGCAGGAAATATCCTTCTGACAGAACCAGGCCAAGTGAAACTTGCTGACTTTGGATCTGCTTCCATGGCTTCCC
CTGCCAATTCTTTTGTGGGAACACCATATTGGATGGCCCCAGAAGTAATTTTAGCCATGGATGAAGGACAGTATGATGGC
AAAGTTGATGTATGGTCTCTTGGAATAACGTGTATTGAATTAGCCGAGAGGAAGCCTCCTTTATTTAATATGAATGCAAT
GAGTGCCTTATATCACATAGCCCAAAATGAATCCCCTACACTACAATCTAATGAATGGTCTGATTATTTTCGAAACTTTG
TAGATTCTTGCCTCCAGAAAATCCCTCAAGATCGCCCTACATCAGAGGAACTTTTAAAGCACATGTTTGTTCTTCGAGAG
CGC
Sequence Type genomic DNA
Unitrap ID UNI14534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77377156..77393347 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es