Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S7-2C1
Clone ID FHCRC-GT-S7-2C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S7-2C1
Sequence
GTGATGGACAGAATCTGTTTACTAAAGACGTGACAGTGATTGAAGGAGAAGTGGCAACCATCAGCTGCCAGGTCAATAAG
AGTGACGACTCAGTGATCCAGCTCCTGAACCCCAACAGGCAGACCATTTACTTCAGGGACTTCAGGCCTTTGAAGGACAG
CAGGTTTCAGCTGCTGAATTTTTCTAGCAGTGAACTCAAAGTGTCACTGACGAATGTCTCAATCTCGGATGAAGGGAGAT
ACTTCTGCCAGCTCTACACGGACCCCCCACAGGAGAGTTACACCACCATCACAGTCCTGGTTCCTCCACGTAACTTGATG
ATCGATATCCAGAAAGACACGGCAGTTGAAGGGGAGGAGATTGAAGTCAACTGTACTGCCATGGCCAGCAAGCCAGCGAC
GACCATCAGGTGGTTCAAAGGGAACAAGGAACTCAAAGGCAAATCAGAGGTGGAGGAGTGGTCGGACATGTACACTGTGA
CCAGTCAGCTGATGCTGAAGGTGCACAAGGAGGACGACGGGGTCCCGGTGATCTGCCAGGTGGAGCACCCTGCGGTCACT
GGAAACCTGCAGACCCAGCGCTATCTAGAAGTGCAGTATAAACCGCAAGTGCATATCCAGATGACTTACCCTCTGCAAGG
CCTAACCCGGGAAGGGGATGCATTTGAGTTAACGTGTGAAGCCATCGGGAAGCCCCAGCCTGTGATGGTAACTTGGGTGA
GAG
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47596054..47621881 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es