Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S7-1G1
Clone ID FHCRC-GT-S7-1G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S7-1G1
Sequence
TCGTTGCCCCAATCACCCATGTTGTCCGTCACATTAGATGGGATTCCTGAAGTGATGGAAACTCAGCAAGTGCAAGAGAC
AAATGCAGACTCCCCAGGAGCCTCCTCCCCAGAGCAGCGCAAGAGAAA
Sequence Type genomic DNA
Unitrap ID UNI14536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79966990..79967116 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es