Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S7-1D1
Clone ID FHCRC-GT-S7-1D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S7-1D1
Sequence
ACGGAAGAAGCCCACCACCGAGGGCTTCACCCATGACTGGATGGTCTTCGTGCGTGGCCCTGAGCAGTGTGACATCCAGC
ACTTTGTGGAGAAGGTCATCTTCCGGCTGCATGACAGCTTCCCTAAACCCAAGCGTGGTGAGTTCCCTTTCCCTGCCCTT
CCTCACCCATGGTCCCTGTGAGCTTGGAGGTGGCAGGACCCCTTGACTAGTGCCTGTGTCCCGCCTACTCATGGGAACTG
GCTGGGGACATGTGGGTGCTGGAGCAGCCAGGAAGCATCCTGGGTCAGAAGCAATTAGGGTGATGGCTTAAGAACTCTCT
GAGAAGTCTGACTGGGTATACAAACAACTCTTGAGGACTGAACCCATGCCCAGCACAAATAAACTCAGCAGTATTTTGGA
GTTGTTTGGGTTTTTTTGTCTTGTTTTTATTTATTCTTTCTCACAGTGCTTTGTCTGGGCTTTCCCCCCCCTTGTACATT
TTTTGCTTATATGTTAGGTATGTGTATGTTTCTTGTTCTTTCTCTTTGGCTCTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI14537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57066011..57066551 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024212 (Mllt1) NM_022328 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 Gene [Source:MGI Symbol;Acc:MGI:1927238]

 
Come back to gene ENSMUSG00000024212


For any suggestions or comments, please send an email to unitrap@crg.es