Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-9B1
Clone ID FHCRC-GT-S6-9B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-9B1
Sequence
ACCCAGGTGGGGACCTCACCAGCCCCAACAACCCCCACAGAAGAGGAAGACCTCCGCCGCCGCCTCAAGTACTTCTTTAT
GAGCCCATGTGACAAGTTCCGGGCCAAAGGCCGCAAGCCCTGCAAGCTGATGCTGCAGGTGGTCAAGATCTTGGTGGTCA
CTGTGCAGGTGAGACCAGCCAGGCAGGACCTTGGCCAAATGCTTCCATAGTCACTGTTTGCATCTTAGAGTGGCCCCTTG
CTGCCATGTAATAATGATGACAGTGGTATTACCAGTCAGGAAGAAATCTGAGATTTGTGGTCAGTAATTCTTTTTAGCTC
CCAGAAGCACTGGCCACTCTCTCACCTCCGTTGTATACCCAAAATGCCCCCGAGGCTCACACAATTATTGTGTAAAGTTA
CCCAGTGGCTGAGCACAGGATAGATGGGATTTGAATCCAGTCAATCTGATGTTATCCTTTCTGATCTCCCCTCAGCAAAA
GCAGACTACTACTGTTCCCTATCATGGAGGCATGTTTTAAGTTGTAAATGAAGCTAAATGCAGTGGAGACTTAGCCCTAT
TATATTTTTGCCCCCCAAGTTAGACAACAGGAAACTTGAGCCTTCAGTTGCCACTTTTCAGATGTGTTGGCAGTGGATTT
TAACCATGTGTCTATGGGACCAATTTAGAATCAGTTGCCTTTCAG
Sequence Type genomic DNA
Unitrap ID UNI14543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3505776..3963800 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004567 (Mcoln1) NM_053177 mucolipin 1 Gene [Source:MGI (curated);Acc:Mcoln1]

 
Come back to gene ENSMUSG00000004567


For any suggestions or comments, please send an email to unitrap@crg.es