Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-8F1
Clone ID FHCRC-GT-S6-8F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-8F1
Sequence
GTATAGCAGTGTTTTACCTGCATGTATGTAAGTGCACCATGTTCGTGCCTGGTGTCTTCAAAGGCTGTGGGATCAGCCAG
AACTGGAACTATGGACTGTATTGAGCTCCCCAGTTGGGTGCTGGTATGGAATCTGTGTCTTCTGAAAGAACAAGGACGGT
TTAACTCCTGAGATTTCTCAGCCACCAATGTTTAGACAAACCTCAATAAAATGACTCTTCAGGAGTTGGTGCTTCGGACT
GCCTCTGTCTATATGGATAGAACAGCTGTATGTTTTGACGAAGGCAATAACCAGCCTCCAGTGTGCTATTCCTACAAGGC
TCTGTTGAGCGCGGCTTCAGAATTATCCCATTTTCTGATAGCACACTGTGACTTTGGAGGAATTCGGGAAATTGGTCTCT
ATTGTCAACCTGGGATAAACTTACCCTCCTGGATTTTAGGGATTCTTCAGGTCCCCGCAGCGTATGCGCCCATTGATCCA
GACTCCCCACCGTCCTTATCAACTTACTTTATGAAAAAATGTGACCTAAAGTATGTTCTCGTTGAAAAACAGCAGCTTAG
TAAATTCAAATCTTCACATGAGACAGTTCTGAACTATGACACAGTTTCCGTGGAACACAAGGACCTGGCACTCTTCAGAC
TGCATTGGGAAGATGGTCGGGTGAGCACAGTGCTTGGTGACAGAGCAGATCAGCACAAGGTGACGGATAGAGAAGACAGA
GT
Sequence Type genomic DNA
Unitrap ID UNI14545

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77325555..77333405 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]

 
Come back to gene ENSMUSG00000055923


For any suggestions or comments, please send an email to unitrap@crg.es