Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-7G1
Clone ID FHCRC-GT-S6-7G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-7G1
Sequence
AGTTAGAATCATGGCTGCGGGAAAGTTTGCAAGCCTTCCCAGAAACATGCCTGTGAATCACCAGTTCCCCTTGGCCTCGT
CCATGGACNTCCTGAGCAGCAAGTCCCCTCTTGCTGAGCGTCGCACAGATGCCTATCAAGACGTGTCTATACATGGCACT
CTTCCACGGAAGAAAAAGGGCCCTCCTTCCATACGGTCCTGTGACAATGCTGGCCACTCCAAATCCCCACGACAGAGCTC
ACCTCTGACCCAGGACATCATCCAGGAAAACCCACTGCAAGACCGGAAAGGGGAAAACTTCATCTTCAGGTAACTCCTGT
CACGTCCTGCGAGAAAAGTCATCTTCCTCAAGGGCTTTATGTTAAATGTATGCGAAGCTATATGAGTCCCACCTTTCCTT
TCTGTCTTCCTTCTGTCCATCCTTCCTTCTGGTGTATGTAAAGCCTGGGGTCCTCTACCCTAGAGGGAAGGATGGACCAA
AAGACCCTGGGCTTTATATACATGAGGCCAGTGCTTGGCCACTGAACTGCATCCGTAGCCCTAGAGAATACTGTGGCCTC
TGTAAAGCCATCCCTGCACCTTAGCAGCCACCAGCTGATCCAGCCAGTCCTATTTTACCTTTATTTCTCCCTCTCTTCCC
GCCTTCAGTATTAGTGAAGAGAGCCACAAGTCTAATTTTCTAATAAACTCATTTTATCTAA
Sequence Type genomic DNA
Unitrap ID UNI14547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122129363..122130064 696
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es