Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-6F1
Clone ID FHCRC-GT-S6-6F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-6F1
Sequence
GACGCACAGACACTCAGGTGGCTCAGCCAGGACAGCCACAGCAGCCAGTGAACAAAGCCCTGGCGCTAGGAACCGCCACC
GCCAGCCTGTGAAGAACTCTAGCAGCAGTGGCTTAGCCAATGGCACAGTGAATGAGGAACCTACTCCAGCCAGTGAACCT
GAAGAATCGTCGGTTGTTGGTGTAACATCCCTGCCTGCAGCAGCCTTGAGTGTGTCCTCAAATCCCAACACAACATCTCT
CCCTGCACAGTCCACACCAGCAGAGGGAGAGGAGGCCAGCACTTCCGGGACACAGCAGCTCCCTGCTGCCGCCCAGGCCC
CTGATGCTCTTCCTGCTGGGTGAGTAGTCTTGTGTTCCATCATGGCACTCTCCTCACCAGGTTAGAAACACTGTGGTTGT
TGCCCAGTGCTCAGGGGTCTCTGGCAAAGCTGCCATGTATAGAAGCAAGAGTGGTGTCAAAGTGCTTGCTCTGTGTACAT
CTCACGGAGCACCTGAACCACCCGTGCTGGCCAGTGCTGCTTTATGCTGGGACTTAAGTGGACAGCCTCTGTGGAACAAG
GAGCTCATTGCCTTCGTGGGTTGTGGGAGGATGTCTGACTAGTGACTAGCTTTTTCCCTCCTGAGCTTGACCTTGGCAGT
CCACAAAGGATTCAGGCTTTAGGTGCTCAGTTGCTGTGACTGTGTTATTTCCTCAGCTGTGGCCAGTGTTAAGTTGGGTA
CTC
Sequence Type genomic DNA
Unitrap ID UNI10004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 110030207..110042395 598
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es