Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-6C1
Clone ID FHCRC-GT-S6-6C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-6C1
Sequence
TCCTCTGCTCGGGAATCGGATGATGAAGTCTCCAGCAGCGAAAGTGCTGACAGCGGGGATAGCGTCAATCCATCCACCTC
AAATCACTTCACCCCTTCCTCCATCCTGAAAAGGGAGAAACGGCTGAGGACGAAGAATGTACACTTCAGCTGTGTCACCG
TGTACTACTTCACCAGGAGGCAGGGCTTCACTAGTGTGCCCAGCCAGGGTGGCAGCACTCTGGGGATGTCCAGTCGTCAC
AACAGCGTGCGCCAGTACACCCTGGGCGAGTTTGCGCGAGAGCAGGAGCGCCTGCACCGGGAGATGCTGAGAGAACACCT
CCGGGAGGAGAAACTCAACTCTCTCAAACTAAAGATGACTAAGAATGGCACTGTAGAGTCTGAGGAAGCTAGCACCCTGA
CCGTGGATGACATTTCCGATGACGATATTGATCTGGACAACACCGAAGTGGACGAATACTTCTTCCTACAACCCCTGCCC
ACAAAAAAGCGGAGAGCTCTGCTGCGCGCCTCGGGGGTGAAGAAGATCGACGTTGACGAGAAGCACGAACTGCGGGCCAT
CCGCCTTTCTCGGGAGGACTGTGGCTGTGACTGCAGAGTGTTCTGTGATCCAGAAACCTGTACCTGCAGCCTGGCAGGCA
TTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI14549

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65787093..65857789 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044647 (Csnrp3) NM_153409 cysteine-serine-rich nuclear protein 3 Gene [Source:MGI Symbol;Acc:MGI:1925021]

 
Come back to gene ENSMUSG00000044647


For any suggestions or comments, please send an email to unitrap@crg.es