Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-5D1
Clone ID FHCRC-GT-S6-5D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-5D1
Sequence
GCCGCTAGACATCATCTCCATGGCTGAGACCAGCATGATGCCAGAGGAGATCGAGCTGGAGATGGCGAAAATCCAGCGTC
TCCGTGAAGTCCTGGTCCGTCGAGAGTCAGAACTCAGGTTCATGATGGATGACATTCAGCTCTGCAAGGACATCATGGAC
CTGAAGCAGGAGCTGCAGAACTTGGTCGCCATCCCAGAAAAAGAAAAAACCAAGCTGCAGAAGCAGAGAGAGGATGAGCT
CATCCAGAAGATCCACAGACTGGTACAGAAGAGAGACTTCCTGGTGGATGATGCCGAGGTGGAACGCTTAAGGGAACAGG
AAGAAGACAAGGAAATGGCTGATTTCCTGAGAATCAAGTTAAAACCTCTAGACAAAGTAACCAAGACTTCAGCCAGTGAG
TGCCTGCATGGCTTTCCCTCTTTCCCTACAAATGATGATTTCAAAGAAGTGAAGGGCAAGGGAGCATAAGACATGCTTTA
TAGATCCATGGACTAGCAGCAAGCAGGGGGAGGCTCATGGGCCTTGCTCATGCAGTTTCCCAGGCCATGTCCTGACATGC
TCCATGCTCCATTTAAGGTTTCGCTTCATTAATAGTCTTGAAACTCTTAGTAATTTTGGTTCCAGGAGCTTTGTGCTGTC
ATTTTCCCGAGTGTGAGTAAGTAGTACTGCCAGAAGCTGTCCTTGCATAGGCCCAGTTTGGTAATTTTCAAATTGGATGG
CTACT
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14049480..14096409 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es