Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050D2
Clone ID IST15050D2
Vector VICTR80
Project tigm

Sequence tag IST15050D2HMR1
Sequence
NNCTGCCAGATTCCAAGCTCGTAGTGACNAACACGGGGCTAGGGTATGAGTATATGGGTAAATGAGAACGCCAAAGCTTC
AGGAGGTGAGTTTCCATGAAACTCTTTTCCTCGTGAGTGCTTACAGACTTTTCAGCCTGTCAAGCAGACTTGACTGGAGT
ACGTGGCAGTGGAATTGATAAAGTTTCCACAGATAGACAAAAATATGCTCAGTTGTAAACTTATATTGTTGTTTTGGGGT
TTCAAAAACAATTGGCGATGTAAACCATTCTTAATCACAGAGAATACATCAGATTTTGTCTATGCACATTTCCAGACTCC
TAGAACAAACCAACCCATGAAGGTAGAAATGAAGAGATCAAAACATCTTTGAAAATTTTATTTCTCACTCCTAGGACCAT
ATCTCAGATCAACTGAGTCAAACTTCCATAATATAATAGATGTATATTTGAATGAAACAGACATATTTGTGGACAATAAA
ATACCAAAAAACTATTTCCCTCANCTATGCCTGGATAGGTATGTCNCCATAGCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39079339..39079871 527
NO GENE  


Sequence tag IST15050D2BBF1
Sequence
GCAGGAATGCAGTAAAGAAGTTACCTATTCAGTAACTGATTAAGCATTACAAAAGACGGAGCCAGTAGCTCAGAGCTGCT
CTGCAAAATATTTACTAAGGACAGTAGCAAATCTCACCCACACAAGGGAATACCATAATAGAGCTAGGGAATCCCACTGA
GACAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39079868..39080038 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]


Sequence tag IST15050D2HMF1
Sequence
GCAGGAATGCAGTAAAGAAGTTACCTATTCAGTAACTGATTAAGCATTACAAAAGACGGAGCCAGTAGCTCAGAGCTGCT
CTGCAAAATATTTACTAAGGACAGTAGCAAATCTCACCCACACAAGGGAATACCATAATAGAGCTAGGGAATCCCACTGA
GACAGAGATCTTCTCTACAGCTAGGTATAGCAAGCTTCACATTAGAAGCAAGTTGGTGAATTCTTCTGTAGACCCAGGAA
ATAGGGGGGAGGGTTGGGGTATTGCAGTATTCATGATAAGGTCTGCTAGTGCAGAACCCTTGGTGGTGGGTTTAACAATA
GACTAGTTTACATCTCTTCTTTGTGGCAGCAGCCTGGTCCCCACCTTCTTTTGATGTATACATTCCTTTTGTATTGCGTC
ACTATAACTTGGNGGATTGNANTTTGCCTGGTTTCTTGNTATTTCTTTGGNATAAAAAGTTTGATGCTCGACCTGACAAA
NNNCATTNNNANTCTAN
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39079868..39080363 472
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es