Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626B3
Clone ID IST14626B3
Vector VICTR74
Project tigm

Sequence tag IST14626B3BBF1
Sequence
ACAGGGCTGCTCTTCCTGAAGTGGGCCCCCCTGCCTTACTTGCTCACCTAGTTCCCTTTTTAATTTTGGGATGTATCATG
CGCATGCAGACACGAGCAAGCGAGCGAGCGCTGGTCTGCTGGAGGTAGAGGTCGGAGGACAGCCTCTGCCGTGGGTCTTT
TACCCTTCCCCTTGCTTGAAACACGTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTGTTTGTTTGCC
GCTGTACAGCCAGAATAATTGAGCCACAAGCCCCTGGGGATGTTCTCTGGAGCTCCTGTCTCACCTCANAAACGCTGGGG
TTCCACAGGCAGGTGTTACCCTACCCAGCCTTATGCAGCTGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88293413..88293779 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]


Sequence tag IST14626B3HMF1
Sequence
ACAGGGCTGCTCTTCCTGAAGTGGGCCCCCCTGCCTTACTTGCTCACCTAGTTCCCTTTTTAATTTTGGGATGTATCATG
CGCATGCAGACACGAGCAAGCGAGCGAGCGCTGGTCTGCTGGAGGTAGAGGTCGGAGGACAGCCTCTGCCGTGGGTCTTT
TACCCTTCCCCTTGCTTGAAACACGTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTGTTTGTTTGCC
GCTGTACAGCCNGAATAATTGAGCCNCAAGCCCCTGGGGATGTTCTCTGGAGCTCCTGTCTCACCTCAGAAACGCTGGGG
TTCCACAGGCAGGTGTTACCCTACCCAGCCTTATGCAGCTGGGGATCCACACTCAGGTCTTCATGTTTGTGTGGAAGTTC
CTGACCCNNGACCATCTCCCCAGCCCTTANTTTTNATTTTGCTGTGGTGGGCTCCTCATGANAATCNTGCNNANGCTACN
ANTGCNNGNCNCNTCCN
Sequence Type genomic DNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88293284..88293779 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es