Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S6-11C1
Clone ID FHCRC-GT-S6-11C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S6-11C1
Sequence
GAGGTCACTGCAGAGGAGCCCAGNTGCTGCTGTTCCTGATGAGATCCCCCCTCTGGAAGGCGATGAGGATGCCTCGCGCA
TGGAAGAGGTGGATTAAAGCCTCCTGGAAGAAGCCCTGCCCTCTGTATAGTATCCCCGTGGCTCCCCCAGCAGCCCTGAC
CCACCTGGCTCTCTGCTCATGTCTACAAGAATCTTCTATCCTGTCCTGTGCCTTAAGGCAGGAAGATCCCCTCCCACAGA
ATAGCAGGGTTGGGTGTTATGTATTGTGGTTTTTTTGTTTGTTTTATTTTGTTCTAAAATTAAAAGTATGCAAAATAAAG
AAGATGCAGTTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45704727..45705059 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]

 
Come back to gene ENSMUSG00000023944


For any suggestions or comments, please send an email to unitrap@crg.es