Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12392E9
Clone ID IST12392E9
Vector VICTR76
Project tigm

Sequence tag IST12392E9HMF1
Sequence
AAAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGAACCTCTGGAAAAG
CAGTCAGTGCTCTTAACTGATAAGCCATCTCTCTAGTCTCTAGCTTGATTTTTAAACTTTGACTTTTAAATATACTTATT
CATTATAATTTTTTTTCTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCAGGC
TGGCCTCGAACTCANAAATCCGCCTGCCTCTGCCTCCCGAGGGCTGGGATTAAAGGCATGCACCNNCNTGCCCGGCTTAT
ATTTTGANTTTNATGGNANATTANNANGGATGTNANNANTGN
Sequence Type genomic DNA
Unitrap ID UNI34473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95726049..95726401 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]


Sequence tag IST12392E9BBF1
Sequence
AAAGGGCNTCANATCCNNTTACAGATGGTTGTGANCCNCCNTGTGGTTGCTGGGAATTGAACTCAGAACCTCTGGAAAAG
CAGTCAGTGCTCTTAACTGATAAGCCATCTCTCTAGTCTCTAGCTTGATTTTTAAACTTTGACTTTTAAATATACTTATT
CATTATAATTTTTTTTCTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCAGGC
TGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGGGCTGGGATTAAAGGCATGCACCACCATGCCCGGCTTAT
ATTTTGATTTTAATGGGATATTAAGATGGATGTTAAGATTGTGAGCTTTCAACCCTGTCTCGGAAAACCNAAAAAAAAAA
AAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI34473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95725996..95726401 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es