Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14889D6
Clone ID IST14889D6
Vector VICTR76
Project tigm

Sequence tag IST14889D6HMR1
Sequence
CTGGCACGGAGACAGCAGGGGACAGACTGGGGCAGGGGGAGTTCCCACCCTCGAANAAATGGGCACCCTCACGTGGGTTT
CTCTTCACATTGAGAGCGTCTGTTTGGGCAACAGTTTGCAAAGTGTACTTTAACCTACAGTTCTTTTTAGCTTTTTTTTT
TTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264301..86264462 160
 
EST/CDNA Est Name
  BY150297.1


Sequence tag IST14889D6HMF1
Sequence
CCAGGAACAGGCAGAGAATCTCCTTGGGACTTGTCTGGGACGGAGCTGCTGGCTGAAAGGAACTTACCAGGCTGTGGTTT
GAACTTGGCTTTCATCATGACTTTCCCGCCCCACCCTGGGTGCCTCAACCGTTGTTTGATGGCTAAGTCACCTAANTNNN
NTGACAACAAACAGTGAAAAAATGGAACGGGGCACCN
Sequence Type genomic DNA
Unitrap ID UNI6526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264109..86264304 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es