Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051H7
Clone ID IST15051H7
Vector VICTR80
Project tigm

Sequence tag IST15051H7HMF1
Sequence
GGGCTCAGCTCATCGTTCCTCTTATGTGTATGCTTATAAGGTTTTCATTGAGGCAGAGGTAGATAGTTGACCCCAAGTTC
GAGGTCAGCTTGAACTACCTACTGAGTTCCTGCTTAATCAAGGCGATCGGCCTCGTCTCCAACAGTTTTCAGCAATAACT
CTTCCAAAACGGAATTCTTTGCAAATGAAATGATCATCCGGTTTATTCGGGGCGAGCTGCCGGGTGCTGGTGCTCTTGTC
TTCGGAAAGCAAGCAGGCTATGGGGTCTAAGGCAAAGAGGCAGAGCAGCTTCTGGCGGGACCGACTCAAGCTCCGCGCCA
CCACGCGGACCAAAGAACGCGCACGCTTCATTCAAGGCAGAATCTGACAAATCACTCTCCGTGAACGCTCGGGCTCANAN
AACCGCGGANCTCAATTTGGNNNNNNNACACNCCGGGGAACCCAAGCAGCTGGGCTGGAGANCTCTCGGGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108595162..108595633 448
 
EST/CDNA Est Name
  CR758969.1 - CR758927.1 - CR758967.1


Sequence tag IST15051H7HMR1
Sequence
CCNCTGCCTGCGGGGCGACCCTGCCTGCCCTGGGACTTCGAGGTCCTGGTCAGGATCCCCAGGTGAGAGGGAAGAAAAAG
GGAGAAATTCTGACTACACAAACAGGATTGGGAAGAATCCCACGAAAAAAGTCGGTTGTCAGGCGGTCGCATCTCTGCCT
GCCACCTGGTGTAGTAACTTTGGGAACACTTTTTCTCGAGCCTTGGTCTTCTATGTCTGAGAATGCAAGATGATGAAATC
TCTTCCTTCCTCCGGGGGTGTGATACATGAGCGCCCGGGAGTGGAGCGTGGTTTTGCTGTTTTCACTACGTTTGGAGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNTCN
Sequence Type genomic DNA
Unitrap ID UNI22843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35138714..35139066 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es