Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14885H1
Clone ID IST14885H1
Vector VICTR76
Project tigm

Sequence tag IST14885H1HMR1
Sequence
AGAACACCTCAAAGACATTGGCTCCTCACCTTAAGACCCATGCTTTCCGATGAATGGTGGAGTGACTTGCCTGTCCAGTC
GCCCTCCCTCCTTGTGCTGGAAGCCCTCATTCTTGCCCAGGCAGATAGCGTCGTTTGTGTGGGAATGACTGTCCCATTGT
TGGTCTCATCCTAACTTGTGGGCTGAATGANNCTTGNGGTCNGGGCNNGNNNANCN
Sequence Type genomic DNA
Unitrap ID UNI23410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117868715..117868920 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es