Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-7C1
Clone ID FHCRC-GT-S8-7C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-7C1
Sequence
TTTATTGCTTTGATCACCACAGTCTCTACCTTGCTGCTTTCTCCAGAAGCCTTTTTATGTATGGGTTAGAAACTCTTTTT
TCCCTAGTCAGAGCAGCCAGGCTGTACAAAATCTGTGCTCTCTCGGTTCCCCATGCCTCTAGAAGGCCGTTAAAACCAAG
ACTGGATGCACTGAGAGGAGTCTT
Sequence Type genomic DNA
Unitrap ID UNI14571

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40752299..40752482 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es