Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-6D1
Clone ID FHCRC-GT-S8-6D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-6D1
Sequence
GTTGGACCAGAGGGCATCTTGCAAAATGGGGCTGTGGATGACAGTGTGGCCAAGACCAGCCAGCTGCTAGCTGAGCTGAA
CTTCGAGGAAGATGAAGAGGACACATACTACACTAAGGACCTCCCAGTCCACGCCTGCAGTTACTGTGGAATCCATGATC
CTGCCTGCGTGGTTTACTGTAATACCAGCAAGAAGTGGTTCTGCAATGGCCGAGGAAATACTTCTGGCAGCCACATTGTG
AATCACCTCGTGAGGGCAAAATGCAAGGAAGTGACGCTGCACAAGGACGGGCCTCTGGGCGAGACCGTGCTGGAGTGCTA
CAACTGTGGCTGCCGCAACGTCTTCCTGCTGGGCTTCATCCCTGCGAAGGCCGACTCTGTGGTGGTGCTGTTGTGCAGGC
AGCCCTGTGCCAGCCAGAGCAGCCTGATCATCAAAGCCCTCAAGGAGCCACCGAGAGACAGGAAGAAGCAGAAGAACATT
AAACACAGTGGGAACATTACTTTTGATGAGATTGTCAACATTGCCCGGCAGATGAGACACNGGTCTCTGGCTAGAGAACT
TTCTGGAACTATCAAGGAGATCCTGGGTACTGCACAGTCTGTGGGCTGCAATGTGGATGGCC
Sequence Type genomic DNA
Unitrap ID UNI2625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72865511..72868264 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058301 (Upf1) NP_001116301 UPF1 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107995]

 
Come back to gene ENSMUSG00000058301


For any suggestions or comments, please send an email to unitrap@crg.es