Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-6A1
Clone ID FHCRC-GT-S8-6A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-6A1
Sequence
GAGAATGGCCACGTGAGAAGCAATGGAGACTTAACCCCCAAGGGTGAAGGGGAGTCACCACCCGTGAACGGAACAGATGA
GGCAGCTGGGGCTACTGGTGATGCCATCGAGCCAGCGCCCCCTAGCCAGGAAGCTGAGGCCAAGGGGGAGGTCGCCCCCA
AGGAGACCCCCAAGAAGAAGAAGAAATTCTCTTTCAAGAAGCCTTTCAAATTGAGTGGCCTGTCCTTCAAGAGAAATCGG
AAGGAGGGTGGGGGTGATTCCTCAGCCTCCTCGCCAACAGAGGAAGAGCAGGAGCAGGGCGAGATGAGCGCCTGCAGCGA
CGAGGGCACTGCCCAAGAAGGGAAGGCCGCTGCCACCCCTGAGAGCCAAGAGCCCCAGGCCAAGGGGGCAGAGGCTAGTG
CTGCCTCCAAGGAAGGAGACACAGAAGAGGAGGCAGGGCCCCAGGCTGCAGAGCCATCCACTCCCTCGGGCCCAGAGAGT
GGCCCCACACCTGCCAGTGCTGAGCAGAATGAGTAGGGGTGGGGACAGGTGGGTGATCTCTAAGCTTGCAAAAACTGTGC
TGTCCTTGTGAGGTCACTGCCTGGACCTTGTGCCCTNGGCTGCCTTCCTGTG
Sequence Type genomic DNA
Unitrap ID UNI14575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129191961..129192570 604
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047945 (Marcksl1) NM_010807 MARCKS-like 1 Gene [Source:MGI (curated);Acc:Marcksl1-001]

 
Come back to gene ENSMUSG00000047945


For any suggestions or comments, please send an email to unitrap@crg.es