Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-3D1
Clone ID FHCRC-GT-S8-3D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-3D1
Sequence
CTTCAGCACCAGTCAGCAAAGTGAATAAGTTCTGTGCTGCCGCCGCTTCCACCTTCCACTCCACTCCGGGAAGAAAGAGC
GCCATCATGTCAAGCATCACGATTGACCCGGATGTCAAGCCCGGTGAATATGTCATCAAGAGTCTCTTTGCAGAATTTGC
TGTTCAAGCTGAAAAGAAAATTGAAGTTGTAATGGCTGAACCCTTGGTGAGTAGAGCCATCCATAAATCTCATCCCCCCC
CCCCTTT
Sequence Type genomic DNA
Unitrap ID UNI14578

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73539215..73539461 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es