Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0252
Clone ID AC0252
Vector pGT0lxr
Project sanger

Sequence tag AC0252
Sequence
CAAGTTCTCAGGAGGAAAGTGTGACAGCGAACTGAGGCTTTTGGCTGCTCGGCGGGTCACCTCATCTGGAAGAGCGGGAG
GACAAGAGTTTGACGCCTATCGAACGACCCAACTTCCGGTCGGCGGACAAAAACCTAGCGCGCTTCTCCTTTAATTGCGG
TGGGCGGGACGCGGCGACGCCACCGGCGTTGCTATTGGTGGCGATTGGGGGCGCGGAAACTGAACTGGCACAACTGCCGA
CCCAGCTATCTCTGGCACTTGGGGCACAGCTGGTCCTACCAGCCCGCTAGCCCCACCATGGCTGCTCCCAGCCAG
Sequence Type mRNA
Unitrap ID UNI2328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106183474..106183787 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es