Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0377
Clone ID GC0377
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0377
Sequence
ACGCAGTACCTGCGAGGTGCTGTGGTCTTCACTTTAAAACACACATTTCGGTCTGTTGGGTTGCCAAG
Sequence Type mRNA
Unitrap ID UNI241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173587653..173587720 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es