Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-11H1
Clone ID FHCRC-GT-S8-11H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-11H1
Sequence
GGGTCGCCAGAAGCCACGGGGACCAACACCTGGCTCCTAGGAGGTGGCTCTTGGAAGGTGGCCAAGAATGTGAATGCAAA
GATTGGTTCCTGCAAGCCCCAAAGAGAAAAGCCACAGCAGTGCTGGGGCCACCAAGGAAGCAGTGTCCCTGTGATCACGT
CAAGGGCAGGGAGAAAAAAAACAGACACCAAAAGCACCACAGGAAGTCGCAAAGACCCTCCAGAGCCTGCCAGCAANTTC
TCAAACGATGTCACCTGGCAAGCTTTGCGCTGCCCTTATAGTACTGAGACTCTGCTCCTCTAGTTAGACTCTCTCAGTGG
AAAGGAGGTGACCAGCCCTAGCACGGTTCTTATTCTCCCCACCCCCATCCTCACCAAGAGCACCCCAGTGCTCTCTGAAG
GCACTGCCTCACAGTGTATCTATGACTGTGCCCCTAGTGCCGGCTGCACTTGCCACTCTTGTCTTATGCCTTCTGTTTAC
CCTACAAGAATGCAGGACACCTCGGCCTCCTGNTGGCCTCACATTGCAATCAGAAAACTTGCAATGAAAATATTTAATNC
ATAGTGCATAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26185076..26187956 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060188 (Cxcl17) chemokine (C-X-C motif) ligand 17 Gene [Source:MGI Symbol;Acc:MGI:2387642]

 
Come back to gene ENSMUSG00000060188


For any suggestions or comments, please send an email to unitrap@crg.es