Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12931H6
Clone ID IST12931H6
Vector VICTR76
Project tigm

Sequence tag IST12931H6HMF2
Sequence
CATCAATACTCCTTTATTCNTTAAAAATATTTCAATTTTGGTTATGCCAACAATGAAAGCGATTATTGATTATTTCGTGC
TACTTGAATTTGTCTCATTTACTTTAGGAACACGGATAAGTCATCCAACTTAAAGCTTCAAACGTCTGGCGATTTATTAT
GGACGTATTGAAAAAACCAACGGGAAAGAACTATACNAGCCNCTTTCCTGGAATACCTTCATGTTTTATTATAATGAAAT
AAATTATTTTATTATACTTTTCTCCTCTTTTGAAAGACGACGACNGACTTTGAGGTTTTANCAAAACNGCTTGCTGTATT
TANGATCTTCCNTTTANGAANATGACCTCNAAATGTCCGTCATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35977470..35977835 342
 
EST/CDNA Est Name
  BB840129.1 - BB052447.1 - BU510889.1 - AA086687.1


Sequence tag IST12931H6BBF1
Sequence
CTAGCATGCATCATTAGCATGATCATTCCCGAAATGGCTGGGGACAAGGTCCAGTCAGCTCGTGGGGCAGGCANTAAATT
GCANAGGCATTGTAAAAGTCGTTGTGAACGCAGGGAAATTGGCANCTCCCTTCANCCCCATANTCTCCTTGAACGCCCAT
CTAAAAGGTCTTGTCCTACATCAAGTGTCTTCTGGCCNTGANTGGCTCTCTCCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22140993..22141211 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es