Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14192D6
Clone ID IST14192D6
Vector VICTR74
Project tigm

Sequence tag IST14192D6HMR1
Sequence
ANANAACTCTTCCCCCATCAGTGCCCCAGCTAACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55709334..55709367 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST14192D6HMF1
Sequence
GTCTGACCCTGGAAGACCATTAAATTGATTTCTTGGCCTGCTTATGAGCCTCCACAAAACATAACCGCTACCTCTCACCC
AGCCCTTTGCTTGTGACATCTTCTCCTTGGGTTAAAATGCTGGATGACAGGATAAAGGATAAACAAACAAGCAAACAAAA
CCCTCAGCAACTTTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55709368..55709545 178
NO GENE  

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es