Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S8-11B1
Clone ID FHCRC-GT-S8-11B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S8-11B1
Sequence
ATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAG
GGTGGCCGGNCGGNGAGTCTAAACCCAAGAGTGATGGAAAGAACTCAAATGGATCCAAGCGTTACAATCGCAAGCGTGAA
CCCTCCTACCCCAAAAATGAAAATTTTAGCAACCAGTCCCGTCGCTCCAATTCACAGAAAAGCAAAACTTTTAACAAGAT
GCCTCCTCAAAGGGGCGGTGGCAGCAGCAAACCCTTTAGCTCTTCTTCTAATGGTGGAAGACGAGATGAGGTAGCAGAGG
CTCAGCGGGCAGAGTTTAGCCCTGCCCAGTTCTCTGGCCCTAAGAAGATCAACCTGAACCACTTGTTAAATTTCACCTTT
GAACCACGTGGCCAGGCAGGTCACTTTGAAGGCAGTGGGCATGGCAGCTGGGGGNAAGAGAAACAAGTGGGGNACACAAG
CCTTTTCAACAAGGNAGCTCTTTTCTACAGGCCAACTGCCAATTTGTGGTGTCTGAAGACCAAGACTACGCAGNTCANTT
TGCTGACCCTGACACCTTA
Sequence Type genomic DNA
Unitrap ID UNI14584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115705386..115722295 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es